circad | circRNAs associated with diseases

hsa_circ_0008305 (circPTK2)
Gene	PTK2	Organism	Human
Genome Locus		Build	hg19
Disease	Non-Small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink		PMID	30261900
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Seventy-three fresh NSCLC tissues and paired adjacent noncancerous lung tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACATTATTGGCCACTGTGGATGAG Reverse GGGCCAGTTTCATCTTGTTGATGAG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Wang, L, Tong, X, Zhou, Z, Wang, S, Lei, Z, Zhang, T, Liu, Z, Zeng, Y, Li, C, Zhao, J, Su, Z, Zhang, C, Liu, X, Xu, G, Zhang, HT (2018). Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-펲-induced epithelial-mesenchymal transition and metastasis by controlling TIF1펳 in non-small cell lung cancer. Mol. Cancer, 17, 1:140.